ID: 1176553195

View in Genome Browser
Species Human (GRCh38)
Location 21:8238978-8239000
Sequence AATCTATTTTGTGGCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176553195_1176553203 6 Left 1176553195 21:8238978-8239000 CCCTTGAGGCCACAAAATAGATT No data
Right 1176553203 21:8239007-8239029 CACCCATCGACGTTTCCCCCGGG No data
1176553195_1176553206 12 Left 1176553195 21:8238978-8239000 CCCTTGAGGCCACAAAATAGATT No data
Right 1176553206 21:8239013-8239035 TCGACGTTTCCCCCGGGTGCTGG No data
1176553195_1176553202 5 Left 1176553195 21:8238978-8239000 CCCTTGAGGCCACAAAATAGATT No data
Right 1176553202 21:8239006-8239028 CCACCCATCGACGTTTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176553195 Original CRISPR AATCTATTTTGTGGCCTCAA GGG (reversed) Intergenic
No off target data available for this crispr