ID: 1176553209

View in Genome Browser
Species Human (GRCh38)
Location 21:8239024-8239046
Sequence ACAGGATACATCCAGCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176553209_1176553215 22 Left 1176553209 21:8239024-8239046 CCCGGGTGCTGGATGTATCCTGT No data
Right 1176553215 21:8239069-8239091 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176553209 Original CRISPR ACAGGATACATCCAGCACCC GGG (reversed) Intergenic
No off target data available for this crispr