ID: 1176553210

View in Genome Browser
Species Human (GRCh38)
Location 21:8239025-8239047
Sequence GACAGGATACATCCAGCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176553210_1176553215 21 Left 1176553210 21:8239025-8239047 CCGGGTGCTGGATGTATCCTGTC No data
Right 1176553215 21:8239069-8239091 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176553210 Original CRISPR GACAGGATACATCCAGCACC CGG (reversed) Intergenic
No off target data available for this crispr