ID: 1176553212

View in Genome Browser
Species Human (GRCh38)
Location 21:8239054-8239076
Sequence AATTCGACGGTGTCAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176553212_1176553217 21 Left 1176553212 21:8239054-8239076 CCTGAGCCTGACACCGTCGAATT No data
Right 1176553217 21:8239098-8239120 GTGTTTGTTTGTTTCTGAGATGG No data
1176553212_1176553215 -8 Left 1176553212 21:8239054-8239076 CCTGAGCCTGACACCGTCGAATT No data
Right 1176553215 21:8239069-8239091 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176553212 Original CRISPR AATTCGACGGTGTCAGGCTC AGG (reversed) Intergenic
No off target data available for this crispr