ID: 1176553215

View in Genome Browser
Species Human (GRCh38)
Location 21:8239069-8239091
Sequence GTCGAATTAAACACCTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176553209_1176553215 22 Left 1176553209 21:8239024-8239046 CCCGGGTGCTGGATGTATCCTGT No data
Right 1176553215 21:8239069-8239091 GTCGAATTAAACACCTTGACTGG No data
1176553211_1176553215 4 Left 1176553211 21:8239042-8239064 CCTGTCAAGAGACCTGAGCCTGA No data
Right 1176553215 21:8239069-8239091 GTCGAATTAAACACCTTGACTGG No data
1176553212_1176553215 -8 Left 1176553212 21:8239054-8239076 CCTGAGCCTGACACCGTCGAATT No data
Right 1176553215 21:8239069-8239091 GTCGAATTAAACACCTTGACTGG No data
1176553208_1176553215 23 Left 1176553208 21:8239023-8239045 CCCCGGGTGCTGGATGTATCCTG No data
Right 1176553215 21:8239069-8239091 GTCGAATTAAACACCTTGACTGG No data
1176553210_1176553215 21 Left 1176553210 21:8239025-8239047 CCGGGTGCTGGATGTATCCTGTC No data
Right 1176553215 21:8239069-8239091 GTCGAATTAAACACCTTGACTGG No data
1176553207_1176553215 24 Left 1176553207 21:8239022-8239044 CCCCCGGGTGCTGGATGTATCCT No data
Right 1176553215 21:8239069-8239091 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176553215 Original CRISPR GTCGAATTAAACACCTTGAC TGG Intergenic
No off target data available for this crispr