ID: 1176553488

View in Genome Browser
Species Human (GRCh38)
Location 21:8242014-8242036
Sequence CACCGTCTGTCTTCTCGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176553488_1176553499 28 Left 1176553488 21:8242014-8242036 CCTCTGCGAGAAGACAGACGGTG No data
Right 1176553499 21:8242065-8242087 CTTTTTTGAAGGGGCTCCGGTGG No data
1176553488_1176553491 -2 Left 1176553488 21:8242014-8242036 CCTCTGCGAGAAGACAGACGGTG No data
Right 1176553491 21:8242035-8242057 TGTTCCGGTTTGGCCGATTCTGG No data
1176553488_1176553497 19 Left 1176553488 21:8242014-8242036 CCTCTGCGAGAAGACAGACGGTG No data
Right 1176553497 21:8242056-8242078 GGCAACAGGCTTTTTTGAAGGGG No data
1176553488_1176553493 5 Left 1176553488 21:8242014-8242036 CCTCTGCGAGAAGACAGACGGTG No data
Right 1176553493 21:8242042-8242064 GTTTGGCCGATTCTGGCAACAGG No data
1176553488_1176553495 17 Left 1176553488 21:8242014-8242036 CCTCTGCGAGAAGACAGACGGTG No data
Right 1176553495 21:8242054-8242076 CTGGCAACAGGCTTTTTTGAAGG No data
1176553488_1176553498 25 Left 1176553488 21:8242014-8242036 CCTCTGCGAGAAGACAGACGGTG No data
Right 1176553498 21:8242062-8242084 AGGCTTTTTTGAAGGGGCTCCGG No data
1176553488_1176553496 18 Left 1176553488 21:8242014-8242036 CCTCTGCGAGAAGACAGACGGTG No data
Right 1176553496 21:8242055-8242077 TGGCAACAGGCTTTTTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176553488 Original CRISPR CACCGTCTGTCTTCTCGCAG AGG (reversed) Intergenic