ID: 1176553492

View in Genome Browser
Species Human (GRCh38)
Location 21:8242039-8242061
Sequence GTTGCCAGAATCGGCCAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176553492_1176553498 0 Left 1176553492 21:8242039-8242061 CCGGTTTGGCCGATTCTGGCAAC No data
Right 1176553498 21:8242062-8242084 AGGCTTTTTTGAAGGGGCTCCGG No data
1176553492_1176553502 25 Left 1176553492 21:8242039-8242061 CCGGTTTGGCCGATTCTGGCAAC No data
Right 1176553502 21:8242087-8242109 GATGGCACGTCAATGACAGACGG No data
1176553492_1176553495 -8 Left 1176553492 21:8242039-8242061 CCGGTTTGGCCGATTCTGGCAAC No data
Right 1176553495 21:8242054-8242076 CTGGCAACAGGCTTTTTTGAAGG No data
1176553492_1176553499 3 Left 1176553492 21:8242039-8242061 CCGGTTTGGCCGATTCTGGCAAC No data
Right 1176553499 21:8242065-8242087 CTTTTTTGAAGGGGCTCCGGTGG No data
1176553492_1176553497 -6 Left 1176553492 21:8242039-8242061 CCGGTTTGGCCGATTCTGGCAAC No data
Right 1176553497 21:8242056-8242078 GGCAACAGGCTTTTTTGAAGGGG No data
1176553492_1176553496 -7 Left 1176553492 21:8242039-8242061 CCGGTTTGGCCGATTCTGGCAAC No data
Right 1176553496 21:8242055-8242077 TGGCAACAGGCTTTTTTGAAGGG No data
1176553492_1176553500 7 Left 1176553492 21:8242039-8242061 CCGGTTTGGCCGATTCTGGCAAC No data
Right 1176553500 21:8242069-8242091 TTTGAAGGGGCTCCGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176553492 Original CRISPR GTTGCCAGAATCGGCCAAAC CGG (reversed) Intergenic