ID: 1176553494

View in Genome Browser
Species Human (GRCh38)
Location 21:8242048-8242070
Sequence AAAAAGCCTGTTGCCAGAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176553494_1176553498 -9 Left 1176553494 21:8242048-8242070 CCGATTCTGGCAACAGGCTTTTT No data
Right 1176553498 21:8242062-8242084 AGGCTTTTTTGAAGGGGCTCCGG No data
1176553494_1176553502 16 Left 1176553494 21:8242048-8242070 CCGATTCTGGCAACAGGCTTTTT No data
Right 1176553502 21:8242087-8242109 GATGGCACGTCAATGACAGACGG No data
1176553494_1176553500 -2 Left 1176553494 21:8242048-8242070 CCGATTCTGGCAACAGGCTTTTT No data
Right 1176553500 21:8242069-8242091 TTTGAAGGGGCTCCGGTGGATGG No data
1176553494_1176553499 -6 Left 1176553494 21:8242048-8242070 CCGATTCTGGCAACAGGCTTTTT No data
Right 1176553499 21:8242065-8242087 CTTTTTTGAAGGGGCTCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176553494 Original CRISPR AAAAAGCCTGTTGCCAGAAT CGG (reversed) Intergenic