ID: 1176553499

View in Genome Browser
Species Human (GRCh38)
Location 21:8242065-8242087
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176553487_1176553499 29 Left 1176553487 21:8242013-8242035 CCCTCTGCGAGAAGACAGACGGT No data
Right 1176553499 21:8242065-8242087 CTTTTTTGAAGGGGCTCCGGTGG No data
1176553492_1176553499 3 Left 1176553492 21:8242039-8242061 CCGGTTTGGCCGATTCTGGCAAC No data
Right 1176553499 21:8242065-8242087 CTTTTTTGAAGGGGCTCCGGTGG No data
1176553488_1176553499 28 Left 1176553488 21:8242014-8242036 CCTCTGCGAGAAGACAGACGGTG No data
Right 1176553499 21:8242065-8242087 CTTTTTTGAAGGGGCTCCGGTGG No data
1176553485_1176553499 30 Left 1176553485 21:8242012-8242034 CCCCTCTGCGAGAAGACAGACGG No data
Right 1176553499 21:8242065-8242087 CTTTTTTGAAGGGGCTCCGGTGG No data
1176553494_1176553499 -6 Left 1176553494 21:8242048-8242070 CCGATTCTGGCAACAGGCTTTTT No data
Right 1176553499 21:8242065-8242087 CTTTTTTGAAGGGGCTCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176553499 Original CRISPR CTTTTTTGAAGGGGCTCCGG TGG Intergenic
No off target data available for this crispr