ID: 1176554635

View in Genome Browser
Species Human (GRCh38)
Location 21:8249734-8249756
Sequence GCTCCCCGGCACCCGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176554635_1176554653 22 Left 1176554635 21:8249734-8249756 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1176554653 21:8249779-8249801 CCCTCTGCCGCGATCCTTTCTGG No data
1176554635_1176554644 -9 Left 1176554635 21:8249734-8249756 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1176554644 21:8249748-8249770 CCGGGGAGCGGTCCCCGGGCCGG No data
1176554635_1176554646 -2 Left 1176554635 21:8249734-8249756 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1176554646 21:8249755-8249777 GCGGTCCCCGGGCCGGGCCGCGG No data
1176554635_1176554645 -8 Left 1176554635 21:8249734-8249756 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1176554645 21:8249749-8249771 CGGGGAGCGGTCCCCGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176554635 Original CRISPR GCTCCCCGGCACCCGGGGGA CGG (reversed) Intergenic
No off target data available for this crispr