ID: 1176554931

View in Genome Browser
Species Human (GRCh38)
Location 21:8250749-8250771
Sequence CACCGCCGGCGGGCGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176554931_1176554943 -4 Left 1176554931 21:8250749-8250771 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176554943 21:8250768-8250790 GGTGCGTGTGGGAAGGCGTGGGG No data
1176554931_1176554941 -6 Left 1176554931 21:8250749-8250771 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176554941 21:8250766-8250788 GCGGTGCGTGTGGGAAGGCGTGG No data
1176554931_1176554944 1 Left 1176554931 21:8250749-8250771 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176554944 21:8250773-8250795 GTGTGGGAAGGCGTGGGGTGCGG No data
1176554931_1176554945 8 Left 1176554931 21:8250749-8250771 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176554945 21:8250780-8250802 AAGGCGTGGGGTGCGGACCCCGG No data
1176554931_1176554942 -5 Left 1176554931 21:8250749-8250771 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176554942 21:8250767-8250789 CGGTGCGTGTGGGAAGGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176554931 Original CRISPR CACCGCCGGCGGGCGGGGAG AGG (reversed) Intergenic
No off target data available for this crispr