ID: 1176555051

View in Genome Browser
Species Human (GRCh38)
Location 21:8251131-8251153
Sequence CTGAGGGAGCTCGTCGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176555028_1176555051 30 Left 1176555028 21:8251078-8251100 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555032_1176555051 25 Left 1176555032 21:8251083-8251105 CCCGGCGCCCCCTCCTCCGGTCG No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555031_1176555051 26 Left 1176555031 21:8251082-8251104 CCCCGGCGCCCCCTCCTCCGGTC No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555036_1176555051 16 Left 1176555036 21:8251092-8251114 CCCTCCTCCGGTCGCCGCCGCGG No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555044_1176555051 -1 Left 1176555044 21:8251109-8251131 CCGCGGTGTCCGCGCGTGGGTCC No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555034_1176555051 18 Left 1176555034 21:8251090-8251112 CCCCCTCCTCCGGTCGCCGCCGC No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555040_1176555051 9 Left 1176555040 21:8251099-8251121 CCGGTCGCCGCCGCGGTGTCCGC No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555033_1176555051 24 Left 1176555033 21:8251084-8251106 CCGGCGCCCCCTCCTCCGGTCGC No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555047_1176555051 -10 Left 1176555047 21:8251118-8251140 CCGCGCGTGGGTCCTGAGGGAGC No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555039_1176555051 12 Left 1176555039 21:8251096-8251118 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555035_1176555051 17 Left 1176555035 21:8251091-8251113 CCCCTCCTCCGGTCGCCGCCGCG No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555042_1176555051 2 Left 1176555042 21:8251106-8251128 CCGCCGCGGTGTCCGCGCGTGGG No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555038_1176555051 15 Left 1176555038 21:8251093-8251115 CCTCCTCCGGTCGCCGCCGCGGT No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data
1176555030_1176555051 27 Left 1176555030 21:8251081-8251103 CCCCCGGCGCCCCCTCCTCCGGT No data
Right 1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176555051 Original CRISPR CTGAGGGAGCTCGTCGGTGT GGG Intergenic
No off target data available for this crispr