ID: 1176555487

View in Genome Browser
Species Human (GRCh38)
Location 21:8252589-8252611
Sequence CGCCCCGCGTGGAGCACGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176555475_1176555487 10 Left 1176555475 21:8252556-8252578 CCCCGGCGCGCGCCTTGGGGACC No data
Right 1176555487 21:8252589-8252611 CGCCCCGCGTGGAGCACGGGTGG No data
1176555477_1176555487 8 Left 1176555477 21:8252558-8252580 CCGGCGCGCGCCTTGGGGACCGG No data
Right 1176555487 21:8252589-8252611 CGCCCCGCGTGGAGCACGGGTGG No data
1176555468_1176555487 25 Left 1176555468 21:8252541-8252563 CCGGCGTCCCGCGTCCCCCGGCG No data
Right 1176555487 21:8252589-8252611 CGCCCCGCGTGGAGCACGGGTGG No data
1176555474_1176555487 11 Left 1176555474 21:8252555-8252577 CCCCCGGCGCGCGCCTTGGGGAC No data
Right 1176555487 21:8252589-8252611 CGCCCCGCGTGGAGCACGGGTGG No data
1176555467_1176555487 26 Left 1176555467 21:8252540-8252562 CCCGGCGTCCCGCGTCCCCCGGC No data
Right 1176555487 21:8252589-8252611 CGCCCCGCGTGGAGCACGGGTGG No data
1176555469_1176555487 18 Left 1176555469 21:8252548-8252570 CCCGCGTCCCCCGGCGCGCGCCT No data
Right 1176555487 21:8252589-8252611 CGCCCCGCGTGGAGCACGGGTGG No data
1176555482_1176555487 -2 Left 1176555482 21:8252568-8252590 CCTTGGGGACCGGGTCGGTGGCG No data
Right 1176555487 21:8252589-8252611 CGCCCCGCGTGGAGCACGGGTGG No data
1176555476_1176555487 9 Left 1176555476 21:8252557-8252579 CCCGGCGCGCGCCTTGGGGACCG No data
Right 1176555487 21:8252589-8252611 CGCCCCGCGTGGAGCACGGGTGG No data
1176555470_1176555487 17 Left 1176555470 21:8252549-8252571 CCGCGTCCCCCGGCGCGCGCCTT No data
Right 1176555487 21:8252589-8252611 CGCCCCGCGTGGAGCACGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176555487 Original CRISPR CGCCCCGCGTGGAGCACGGG TGG Intergenic