ID: 1176555515

View in Genome Browser
Species Human (GRCh38)
Location 21:8252678-8252700
Sequence GACCGCCGCGACTGCGGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176555505_1176555515 15 Left 1176555505 21:8252640-8252662 CCTTTGCGGGCGTGCAGGGGGAG No data
Right 1176555515 21:8252678-8252700 GACCGCCGCGACTGCGGCGGTGG No data
1176555500_1176555515 26 Left 1176555500 21:8252629-8252651 CCGGGGGTCGGCCTTTGCGGGCG No data
Right 1176555515 21:8252678-8252700 GACCGCCGCGACTGCGGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176555515 Original CRISPR GACCGCCGCGACTGCGGCGG TGG Intergenic