ID: 1176555515 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:8252678-8252700 |
Sequence | GACCGCCGCGACTGCGGCGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1176555505_1176555515 | 15 | Left | 1176555505 | 21:8252640-8252662 | CCTTTGCGGGCGTGCAGGGGGAG | No data | ||
Right | 1176555515 | 21:8252678-8252700 | GACCGCCGCGACTGCGGCGGTGG | No data | ||||
1176555500_1176555515 | 26 | Left | 1176555500 | 21:8252629-8252651 | CCGGGGGTCGGCCTTTGCGGGCG | No data | ||
Right | 1176555515 | 21:8252678-8252700 | GACCGCCGCGACTGCGGCGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1176555515 | Original CRISPR | GACCGCCGCGACTGCGGCGG TGG | Intergenic | ||