ID: 1176556493

View in Genome Browser
Species Human (GRCh38)
Location 21:8256446-8256468
Sequence GACGGCCGCCGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176556493_1176556504 -4 Left 1176556493 21:8256446-8256468 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1176556504 21:8256465-8256487 CGTCGGGTGGGGGCTTTACCCGG No data
1176556493_1176556509 25 Left 1176556493 21:8256446-8256468 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1176556509 21:8256494-8256516 TCGCGCGCCTGCCGCGCGTGTGG No data
1176556493_1176556505 -1 Left 1176556493 21:8256446-8256468 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1176556505 21:8256468-8256490 CGGGTGGGGGCTTTACCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176556493 Original CRISPR GACGGCCGCCGCGGCGGCGG CGG (reversed) Intergenic
No off target data available for this crispr