ID: 1176556510

View in Genome Browser
Species Human (GRCh38)
Location 21:8256501-8256523
Sequence GCGCACGCCACACGCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176556510_1176556525 16 Left 1176556510 21:8256501-8256523 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176556525 21:8256540-8256562 GGGAACCCCCGGGCGCCTGTGGG No data
1176556510_1176556516 -5 Left 1176556510 21:8256501-8256523 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176556516 21:8256519-8256541 TGCGCCCCGCGCCGTGGGGGCGG No data
1176556510_1176556521 5 Left 1176556510 21:8256501-8256523 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176556521 21:8256529-8256551 GCCGTGGGGGCGGGAACCCCCGG No data
1176556510_1176556515 -8 Left 1176556510 21:8256501-8256523 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176556515 21:8256516-8256538 GCGTGCGCCCCGCGCCGTGGGGG No data
1176556510_1176556513 -10 Left 1176556510 21:8256501-8256523 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176556513 21:8256514-8256536 TGGCGTGCGCCCCGCGCCGTGGG No data
1176556510_1176556527 20 Left 1176556510 21:8256501-8256523 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176556527 21:8256544-8256566 ACCCCCGGGCGCCTGTGGGGTGG No data
1176556510_1176556514 -9 Left 1176556510 21:8256501-8256523 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176556514 21:8256515-8256537 GGCGTGCGCCCCGCGCCGTGGGG No data
1176556510_1176556517 -4 Left 1176556510 21:8256501-8256523 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176556517 21:8256520-8256542 GCGCCCCGCGCCGTGGGGGCGGG No data
1176556510_1176556524 15 Left 1176556510 21:8256501-8256523 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176556524 21:8256539-8256561 CGGGAACCCCCGGGCGCCTGTGG No data
1176556510_1176556523 6 Left 1176556510 21:8256501-8256523 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176556523 21:8256530-8256552 CCGTGGGGGCGGGAACCCCCGGG No data
1176556510_1176556526 17 Left 1176556510 21:8256501-8256523 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176556526 21:8256541-8256563 GGAACCCCCGGGCGCCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176556510 Original CRISPR GCGCACGCCACACGCGCGGC AGG (reversed) Intergenic