HTGT WGE

Individual CRISPR Summary

ID: 1176556514

 View in Genome Browser
Species Human (GRCh38)
Location 21:8256515-8256537
Sequence GGCGTGCGCCCCGCGCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176556507_1176556514 8 Left 1176556507 21:8256484-8256506 CCGGCGGCCGTCGCGCGCCTGCC No data
Right 1176556514 21:8256515-8256537 GGCGTGCGCCCCGCGCCGTGGGG No data
1176556510_1176556514 -9 Left 1176556510 21:8256501-8256523 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176556514 21:8256515-8256537 GGCGTGCGCCCCGCGCCGTGGGG No data
1176556508_1176556514 1 Left 1176556508 21:8256491-8256513 CCGTCGCGCGCCTGCCGCGCGTG No data
Right 1176556514 21:8256515-8256537 GGCGTGCGCCCCGCGCCGTGGGG No data
1176556506_1176556514 9 Left 1176556506 21:8256483-8256505 CCCGGCGGCCGTCGCGCGCCTGC No data
Right 1176556514 21:8256515-8256537 GGCGTGCGCCCCGCGCCGTGGGG No data
1176556503_1176556514 28 Left 1176556503 21:8256464-8256486 CCGTCGGGTGGGGGCTTTACCCG No data
Right 1176556514 21:8256515-8256537 GGCGTGCGCCCCGCGCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176556514 Original CRISPR GGCGTGCGCCCCGCGCCGTG GGG Intergenic