ID: 1176560773

View in Genome Browser
Species Human (GRCh38)
Location 21:8344472-8344494
Sequence AAGGGGAATCAGCAAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176560773_1176560778 16 Left 1176560773 21:8344472-8344494 CCATCTCCTTGCTGATTCCCCTT No data
Right 1176560778 21:8344511-8344533 TCTCTCTCTATTCCTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176560773 Original CRISPR AAGGGGAATCAGCAAGGAGA TGG (reversed) Intergenic
No off target data available for this crispr