ID: 1176562889

View in Genome Browser
Species Human (GRCh38)
Location 21:8363234-8363256
Sequence CAACTAGGATTGGTGTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176562889_1176562895 13 Left 1176562889 21:8363234-8363256 CCTTGCTACACCAATCCTAGTTG No data
Right 1176562895 21:8363270-8363292 ACCATATGCATGTTGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176562889 Original CRISPR CAACTAGGATTGGTGTAGCA AGG (reversed) Intergenic
No off target data available for this crispr