ID: 1176562943

View in Genome Browser
Species Human (GRCh38)
Location 21:8363663-8363685
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176562943_1176562958 26 Left 1176562943 21:8363663-8363685 CCCATCTTCTGGTAACATGCCCA No data
Right 1176562958 21:8363712-8363734 CAATAGGCTGATGGCTTGAGAGG No data
1176562943_1176562951 -2 Left 1176562943 21:8363663-8363685 CCCATCTTCTGGTAACATGCCCA No data
Right 1176562951 21:8363684-8363706 CAGGACCCATAACATGGGCAGGG No data
1176562943_1176562954 3 Left 1176562943 21:8363663-8363685 CCCATCTTCTGGTAACATGCCCA No data
Right 1176562954 21:8363689-8363711 CCCATAACATGGGCAGGGGAAGG No data
1176562943_1176562952 -1 Left 1176562943 21:8363663-8363685 CCCATCTTCTGGTAACATGCCCA No data
Right 1176562952 21:8363685-8363707 AGGACCCATAACATGGGCAGGGG No data
1176562943_1176562946 -8 Left 1176562943 21:8363663-8363685 CCCATCTTCTGGTAACATGCCCA No data
Right 1176562946 21:8363678-8363700 CATGCCCAGGACCCATAACATGG No data
1176562943_1176562950 -3 Left 1176562943 21:8363663-8363685 CCCATCTTCTGGTAACATGCCCA No data
Right 1176562950 21:8363683-8363705 CCAGGACCCATAACATGGGCAGG No data
1176562943_1176562957 17 Left 1176562943 21:8363663-8363685 CCCATCTTCTGGTAACATGCCCA No data
Right 1176562957 21:8363703-8363725 AGGGGAAGGCAATAGGCTGATGG No data
1176562943_1176562947 -7 Left 1176562943 21:8363663-8363685 CCCATCTTCTGGTAACATGCCCA No data
Right 1176562947 21:8363679-8363701 ATGCCCAGGACCCATAACATGGG No data
1176562943_1176562956 10 Left 1176562943 21:8363663-8363685 CCCATCTTCTGGTAACATGCCCA No data
Right 1176562956 21:8363696-8363718 CATGGGCAGGGGAAGGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176562943 Original CRISPR TGGGCATGTTACCAGAAGAT GGG (reversed) Intergenic
No off target data available for this crispr