ID: 1176562951

View in Genome Browser
Species Human (GRCh38)
Location 21:8363684-8363706
Sequence CAGGACCCATAACATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176562944_1176562951 -3 Left 1176562944 21:8363664-8363686 CCATCTTCTGGTAACATGCCCAG No data
Right 1176562951 21:8363684-8363706 CAGGACCCATAACATGGGCAGGG No data
1176562942_1176562951 -1 Left 1176562942 21:8363662-8363684 CCCCATCTTCTGGTAACATGCCC No data
Right 1176562951 21:8363684-8363706 CAGGACCCATAACATGGGCAGGG No data
1176562943_1176562951 -2 Left 1176562943 21:8363663-8363685 CCCATCTTCTGGTAACATGCCCA No data
Right 1176562951 21:8363684-8363706 CAGGACCCATAACATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176562951 Original CRISPR CAGGACCCATAACATGGGCA GGG Intergenic
No off target data available for this crispr