ID: 1176565691

View in Genome Browser
Species Human (GRCh38)
Location 21:8388591-8388613
Sequence GCTCCCCGGCACCCGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176565691_1176565703 18 Left 1176565691 21:8388591-8388613 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1176565703 21:8388632-8388654 CTTTCTGGCGAGTCCCCGTGCGG No data
1176565691_1176565699 3 Left 1176565691 21:8388591-8388613 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1176565699 21:8388617-8388639 CCCTCTGCCGCGATCCTTTCTGG No data
1176565691_1176565704 24 Left 1176565691 21:8388591-8388613 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1176565704 21:8388638-8388660 GGCGAGTCCCCGTGCGGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176565691 Original CRISPR GCTCCCCGGCACCCGGGGGA CGG (reversed) Intergenic
No off target data available for this crispr