ID: 1176565962

View in Genome Browser
Species Human (GRCh38)
Location 21:8389546-8389568
Sequence GCGGGGCGGAGCGAGAAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176565962_1176565985 30 Left 1176565962 21:8389546-8389568 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176565985 21:8389599-8389621 CGCCGGCGGTGCGTGTGGGAAGG No data
1176565962_1176565975 13 Left 1176565962 21:8389546-8389568 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176565975 21:8389582-8389604 TCTCTCCTCTCCCCGCCCGCCGG No data
1176565962_1176565981 25 Left 1176565962 21:8389546-8389568 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565962_1176565982 26 Left 1176565962 21:8389546-8389568 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176565982 21:8389595-8389617 CGCCCGCCGGCGGTGCGTGTGGG No data
1176565962_1176565976 16 Left 1176565962 21:8389546-8389568 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176565976 21:8389585-8389607 CTCCTCTCCCCGCCCGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176565962 Original CRISPR GCGGGGCGGAGCGAGAAGGA CGG (reversed) Intergenic
No off target data available for this crispr