ID: 1176565965

View in Genome Browser
Species Human (GRCh38)
Location 21:8389550-8389572
Sequence CCCCGCGGGGCGGAGCGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176565965_1176565976 12 Left 1176565965 21:8389550-8389572 CCTTCTCGCTCCGCCCCGCGGGG No data
Right 1176565976 21:8389585-8389607 CTCCTCTCCCCGCCCGCCGGCGG No data
1176565965_1176565981 21 Left 1176565965 21:8389550-8389572 CCTTCTCGCTCCGCCCCGCGGGG No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565965_1176565985 26 Left 1176565965 21:8389550-8389572 CCTTCTCGCTCCGCCCCGCGGGG No data
Right 1176565985 21:8389599-8389621 CGCCGGCGGTGCGTGTGGGAAGG No data
1176565965_1176565982 22 Left 1176565965 21:8389550-8389572 CCTTCTCGCTCCGCCCCGCGGGG No data
Right 1176565982 21:8389595-8389617 CGCCCGCCGGCGGTGCGTGTGGG No data
1176565965_1176565975 9 Left 1176565965 21:8389550-8389572 CCTTCTCGCTCCGCCCCGCGGGG No data
Right 1176565975 21:8389582-8389604 TCTCTCCTCTCCCCGCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176565965 Original CRISPR CCCCGCGGGGCGGAGCGAGA AGG (reversed) Intergenic
No off target data available for this crispr