ID: 1176565969

View in Genome Browser
Species Human (GRCh38)
Location 21:8389563-8389585
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176565969_1176565990 25 Left 1176565969 21:8389563-8389585 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176565990 21:8389611-8389633 GTGTGGGAAGGCGTGGGGTGCGG No data
1176565969_1176565988 19 Left 1176565969 21:8389563-8389585 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176565988 21:8389605-8389627 CGGTGCGTGTGGGAAGGCGTGGG No data
1176565969_1176565989 20 Left 1176565969 21:8389563-8389585 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176565989 21:8389606-8389628 GGTGCGTGTGGGAAGGCGTGGGG No data
1176565969_1176565981 8 Left 1176565969 21:8389563-8389585 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565969_1176565982 9 Left 1176565969 21:8389563-8389585 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176565982 21:8389595-8389617 CGCCCGCCGGCGGTGCGTGTGGG No data
1176565969_1176565976 -1 Left 1176565969 21:8389563-8389585 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176565976 21:8389585-8389607 CTCCTCTCCCCGCCCGCCGGCGG No data
1176565969_1176565975 -4 Left 1176565969 21:8389563-8389585 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176565975 21:8389582-8389604 TCTCTCCTCTCCCCGCCCGCCGG No data
1176565969_1176565985 13 Left 1176565969 21:8389563-8389585 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176565985 21:8389599-8389621 CGCCGGCGGTGCGTGTGGGAAGG No data
1176565969_1176565987 18 Left 1176565969 21:8389563-8389585 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176565987 21:8389604-8389626 GCGGTGCGTGTGGGAAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176565969 Original CRISPR GAGACGAGGGGACCCCCGCG GGG (reversed) Intergenic
No off target data available for this crispr