ID: 1176565971

View in Genome Browser
Species Human (GRCh38)
Location 21:8389565-8389587
Sequence GAGAGACGAGGGGACCCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176565971_1176565981 6 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565971_1176565990 23 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565990 21:8389611-8389633 GTGTGGGAAGGCGTGGGGTGCGG No data
1176565971_1176565985 11 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565985 21:8389599-8389621 CGCCGGCGGTGCGTGTGGGAAGG No data
1176565971_1176565987 16 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565987 21:8389604-8389626 GCGGTGCGTGTGGGAAGGCGTGG No data
1176565971_1176565988 17 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565988 21:8389605-8389627 CGGTGCGTGTGGGAAGGCGTGGG No data
1176565971_1176565975 -6 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565975 21:8389582-8389604 TCTCTCCTCTCCCCGCCCGCCGG No data
1176565971_1176565982 7 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565982 21:8389595-8389617 CGCCCGCCGGCGGTGCGTGTGGG No data
1176565971_1176565989 18 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565989 21:8389606-8389628 GGTGCGTGTGGGAAGGCGTGGGG No data
1176565971_1176565991 30 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565971_1176565976 -3 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565976 21:8389585-8389607 CTCCTCTCCCCGCCCGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176565971 Original CRISPR GAGAGACGAGGGGACCCCCG CGG (reversed) Intergenic
No off target data available for this crispr