ID: 1176565972

View in Genome Browser
Species Human (GRCh38)
Location 21:8389575-8389597
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176565972_1176565988 7 Left 1176565972 21:8389575-8389597 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176565988 21:8389605-8389627 CGGTGCGTGTGGGAAGGCGTGGG No data
1176565972_1176565990 13 Left 1176565972 21:8389575-8389597 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176565990 21:8389611-8389633 GTGTGGGAAGGCGTGGGGTGCGG No data
1176565972_1176565981 -4 Left 1176565972 21:8389575-8389597 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565972_1176565987 6 Left 1176565972 21:8389575-8389597 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176565987 21:8389604-8389626 GCGGTGCGTGTGGGAAGGCGTGG No data
1176565972_1176565982 -3 Left 1176565972 21:8389575-8389597 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176565982 21:8389595-8389617 CGCCCGCCGGCGGTGCGTGTGGG No data
1176565972_1176565985 1 Left 1176565972 21:8389575-8389597 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176565985 21:8389599-8389621 CGCCGGCGGTGCGTGTGGGAAGG No data
1176565972_1176565989 8 Left 1176565972 21:8389575-8389597 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176565989 21:8389606-8389628 GGTGCGTGTGGGAAGGCGTGGGG No data
1176565972_1176565991 20 Left 1176565972 21:8389575-8389597 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176565972 Original CRISPR GCGGGGAGAGGAGAGACGAG GGG (reversed) Intergenic
No off target data available for this crispr