ID: 1176565976

View in Genome Browser
Species Human (GRCh38)
Location 21:8389585-8389607
Sequence CTCCTCTCCCCGCCCGCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176565965_1176565976 12 Left 1176565965 21:8389550-8389572 CCTTCTCGCTCCGCCCCGCGGGG No data
Right 1176565976 21:8389585-8389607 CTCCTCTCCCCGCCCGCCGGCGG No data
1176565969_1176565976 -1 Left 1176565969 21:8389563-8389585 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176565976 21:8389585-8389607 CTCCTCTCCCCGCCCGCCGGCGG No data
1176565968_1176565976 2 Left 1176565968 21:8389560-8389582 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176565976 21:8389585-8389607 CTCCTCTCCCCGCCCGCCGGCGG No data
1176565970_1176565976 -2 Left 1176565970 21:8389564-8389586 CCCGCGGGGGTCCCCTCGTCTCT No data
Right 1176565976 21:8389585-8389607 CTCCTCTCCCCGCCCGCCGGCGG No data
1176565971_1176565976 -3 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565976 21:8389585-8389607 CTCCTCTCCCCGCCCGCCGGCGG No data
1176565962_1176565976 16 Left 1176565962 21:8389546-8389568 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176565976 21:8389585-8389607 CTCCTCTCCCCGCCCGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176565976 Original CRISPR CTCCTCTCCCCGCCCGCCGG CGG Intergenic
No off target data available for this crispr