ID: 1176565978

View in Genome Browser
Species Human (GRCh38)
Location 21:8389592-8389614
Sequence ACACGCACCGCCGGCGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176565978_1176565990 -4 Left 1176565978 21:8389592-8389614 CCCCGCCCGCCGGCGGTGCGTGT No data
Right 1176565990 21:8389611-8389633 GTGTGGGAAGGCGTGGGGTGCGG No data
1176565978_1176565991 3 Left 1176565978 21:8389592-8389614 CCCCGCCCGCCGGCGGTGCGTGT No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565978_1176565988 -10 Left 1176565978 21:8389592-8389614 CCCCGCCCGCCGGCGGTGCGTGT No data
Right 1176565988 21:8389605-8389627 CGGTGCGTGTGGGAAGGCGTGGG No data
1176565978_1176565989 -9 Left 1176565978 21:8389592-8389614 CCCCGCCCGCCGGCGGTGCGTGT No data
Right 1176565989 21:8389606-8389628 GGTGCGTGTGGGAAGGCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176565978 Original CRISPR ACACGCACCGCCGGCGGGCG GGG (reversed) Intergenic
No off target data available for this crispr