ID: 1176565979

View in Genome Browser
Species Human (GRCh38)
Location 21:8389593-8389615
Sequence CACACGCACCGCCGGCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176565979_1176565990 -5 Left 1176565979 21:8389593-8389615 CCCGCCCGCCGGCGGTGCGTGTG No data
Right 1176565990 21:8389611-8389633 GTGTGGGAAGGCGTGGGGTGCGG No data
1176565979_1176565991 2 Left 1176565979 21:8389593-8389615 CCCGCCCGCCGGCGGTGCGTGTG No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565979_1176565989 -10 Left 1176565979 21:8389593-8389615 CCCGCCCGCCGGCGGTGCGTGTG No data
Right 1176565989 21:8389606-8389628 GGTGCGTGTGGGAAGGCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176565979 Original CRISPR CACACGCACCGCCGGCGGGC GGG (reversed) Intergenic
No off target data available for this crispr