ID: 1176565981

View in Genome Browser
Species Human (GRCh38)
Location 21:8389594-8389616
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176565968_1176565981 11 Left 1176565968 21:8389560-8389582 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565971_1176565981 6 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565969_1176565981 8 Left 1176565969 21:8389563-8389585 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565973_1176565981 -5 Left 1176565973 21:8389576-8389598 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565972_1176565981 -4 Left 1176565972 21:8389575-8389597 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565974_1176565981 -6 Left 1176565974 21:8389577-8389599 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565965_1176565981 21 Left 1176565965 21:8389550-8389572 CCTTCTCGCTCCGCCCCGCGGGG No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565962_1176565981 25 Left 1176565962 21:8389546-8389568 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
1176565970_1176565981 7 Left 1176565970 21:8389564-8389586 CCCGCGGGGGTCCCCTCGTCTCT No data
Right 1176565981 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176565981 Original CRISPR CCGCCCGCCGGCGGTGCGTG TGG Intergenic
No off target data available for this crispr