ID: 1176565987

View in Genome Browser
Species Human (GRCh38)
Location 21:8389604-8389626
Sequence GCGGTGCGTGTGGGAAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176565974_1176565987 4 Left 1176565974 21:8389577-8389599 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176565987 21:8389604-8389626 GCGGTGCGTGTGGGAAGGCGTGG No data
1176565977_1176565987 -6 Left 1176565977 21:8389587-8389609 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176565987 21:8389604-8389626 GCGGTGCGTGTGGGAAGGCGTGG No data
1176565970_1176565987 17 Left 1176565970 21:8389564-8389586 CCCGCGGGGGTCCCCTCGTCTCT No data
Right 1176565987 21:8389604-8389626 GCGGTGCGTGTGGGAAGGCGTGG No data
1176565973_1176565987 5 Left 1176565973 21:8389576-8389598 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176565987 21:8389604-8389626 GCGGTGCGTGTGGGAAGGCGTGG No data
1176565971_1176565987 16 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565987 21:8389604-8389626 GCGGTGCGTGTGGGAAGGCGTGG No data
1176565969_1176565987 18 Left 1176565969 21:8389563-8389585 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176565987 21:8389604-8389626 GCGGTGCGTGTGGGAAGGCGTGG No data
1176565972_1176565987 6 Left 1176565972 21:8389575-8389597 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176565987 21:8389604-8389626 GCGGTGCGTGTGGGAAGGCGTGG No data
1176565968_1176565987 21 Left 1176565968 21:8389560-8389582 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176565987 21:8389604-8389626 GCGGTGCGTGTGGGAAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176565987 Original CRISPR GCGGTGCGTGTGGGAAGGCG TGG Intergenic
No off target data available for this crispr