ID: 1176565991

View in Genome Browser
Species Human (GRCh38)
Location 21:8389618-8389640
Sequence AAGGCGTGGGGTGCGGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176565978_1176565991 3 Left 1176565978 21:8389592-8389614 CCCCGCCCGCCGGCGGTGCGTGT No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565979_1176565991 2 Left 1176565979 21:8389593-8389615 CCCGCCCGCCGGCGGTGCGTGTG No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565971_1176565991 30 Left 1176565971 21:8389565-8389587 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565977_1176565991 8 Left 1176565977 21:8389587-8389609 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565972_1176565991 20 Left 1176565972 21:8389575-8389597 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565984_1176565991 -3 Left 1176565984 21:8389598-8389620 CCGCCGGCGGTGCGTGTGGGAAG No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565980_1176565991 1 Left 1176565980 21:8389594-8389616 CCGCCCGCCGGCGGTGCGTGTGG No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565973_1176565991 19 Left 1176565973 21:8389576-8389598 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565983_1176565991 -2 Left 1176565983 21:8389597-8389619 CCCGCCGGCGGTGCGTGTGGGAA No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565986_1176565991 -6 Left 1176565986 21:8389601-8389623 CCGGCGGTGCGTGTGGGAAGGCG No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data
1176565974_1176565991 18 Left 1176565974 21:8389577-8389599 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176565991 21:8389618-8389640 AAGGCGTGGGGTGCGGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176565991 Original CRISPR AAGGCGTGGGGTGCGGACCC CGG Intergenic
No off target data available for this crispr