ID: 1176567547

View in Genome Browser
Species Human (GRCh38)
Location 21:8395328-8395350
Sequence GCGCACGCCACACGCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176567547_1176567563 17 Left 1176567547 21:8395328-8395350 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176567563 21:8395368-8395390 GGAACCCCCGGGCGCCTGTGGGG No data
1176567547_1176567558 5 Left 1176567547 21:8395328-8395350 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176567558 21:8395356-8395378 GCCGTGGGGGCGGGAACCCCCGG No data
1176567547_1176567554 -4 Left 1176567547 21:8395328-8395350 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176567554 21:8395347-8395369 GCGCCCCGCGCCGTGGGGGCGGG No data
1176567547_1176567560 6 Left 1176567547 21:8395328-8395350 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176567560 21:8395357-8395379 CCGTGGGGGCGGGAACCCCCGGG No data
1176567547_1176567561 15 Left 1176567547 21:8395328-8395350 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176567561 21:8395366-8395388 CGGGAACCCCCGGGCGCCTGTGG No data
1176567547_1176567550 -10 Left 1176567547 21:8395328-8395350 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176567550 21:8395341-8395363 TGGCGTGCGCCCCGCGCCGTGGG No data
1176567547_1176567551 -9 Left 1176567547 21:8395328-8395350 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176567551 21:8395342-8395364 GGCGTGCGCCCCGCGCCGTGGGG No data
1176567547_1176567553 -5 Left 1176567547 21:8395328-8395350 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176567553 21:8395346-8395368 TGCGCCCCGCGCCGTGGGGGCGG No data
1176567547_1176567564 20 Left 1176567547 21:8395328-8395350 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176567564 21:8395371-8395393 ACCCCCGGGCGCCTGTGGGGTGG No data
1176567547_1176567562 16 Left 1176567547 21:8395328-8395350 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176567562 21:8395367-8395389 GGGAACCCCCGGGCGCCTGTGGG No data
1176567547_1176567552 -8 Left 1176567547 21:8395328-8395350 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176567552 21:8395343-8395365 GCGTGCGCCCCGCGCCGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176567547 Original CRISPR GCGCACGCCACACGCGCGGC AGG (reversed) Intergenic