ID: 1176568416

View in Genome Browser
Species Human (GRCh38)
Location 21:8398031-8398053
Sequence CGTCGCCGGGGCGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176568416_1176568438 5 Left 1176568416 21:8398031-8398053 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176568438 21:8398059-8398081 GGTGCCGCGCGCGGGTCGGGGGG No data
1176568416_1176568441 9 Left 1176568416 21:8398031-8398053 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176568441 21:8398063-8398085 CCGCGCGCGGGTCGGGGGGCGGG No data
1176568416_1176568432 -4 Left 1176568416 21:8398031-8398053 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176568432 21:8398050-8398072 GACGGGGGGGGTGCCGCGCGCGG No data
1176568416_1176568436 3 Left 1176568416 21:8398031-8398053 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176568436 21:8398057-8398079 GGGGTGCCGCGCGCGGGTCGGGG No data
1176568416_1176568442 10 Left 1176568416 21:8398031-8398053 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176568442 21:8398064-8398086 CGCGCGCGGGTCGGGGGGCGGGG No data
1176568416_1176568439 8 Left 1176568416 21:8398031-8398053 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176568439 21:8398062-8398084 GCCGCGCGCGGGTCGGGGGGCGG No data
1176568416_1176568434 1 Left 1176568416 21:8398031-8398053 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176568434 21:8398055-8398077 GGGGGGTGCCGCGCGCGGGTCGG No data
1176568416_1176568433 -3 Left 1176568416 21:8398031-8398053 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176568433 21:8398051-8398073 ACGGGGGGGGTGCCGCGCGCGGG No data
1176568416_1176568435 2 Left 1176568416 21:8398031-8398053 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176568435 21:8398056-8398078 GGGGGTGCCGCGCGCGGGTCGGG No data
1176568416_1176568443 13 Left 1176568416 21:8398031-8398053 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176568443 21:8398067-8398089 GCGCGGGTCGGGGGGCGGGGCGG No data
1176568416_1176568437 4 Left 1176568416 21:8398031-8398053 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176568437 21:8398058-8398080 GGGTGCCGCGCGCGGGTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176568416 Original CRISPR CGTCGCCGGGGCGGGGGCGC GGG (reversed) Intergenic
No off target data available for this crispr