ID: 1176571650

View in Genome Browser
Species Human (GRCh38)
Location 21:8418552-8418574
Sequence ACGTGGGTAGTGGGGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176571650_1176571660 3 Left 1176571650 21:8418552-8418574 CCGGCTCCCCCCACTACCCACGT No data
Right 1176571660 21:8418578-8418600 TTCACCTTAATTTAGTGAGTCGG No data
1176571650_1176571663 11 Left 1176571650 21:8418552-8418574 CCGGCTCCCCCCACTACCCACGT No data
Right 1176571663 21:8418586-8418608 AATTTAGTGAGTCGGTTAGGTGG No data
1176571650_1176571662 8 Left 1176571650 21:8418552-8418574 CCGGCTCCCCCCACTACCCACGT No data
Right 1176571662 21:8418583-8418605 CTTAATTTAGTGAGTCGGTTAGG No data
1176571650_1176571664 12 Left 1176571650 21:8418552-8418574 CCGGCTCCCCCCACTACCCACGT No data
Right 1176571664 21:8418587-8418609 ATTTAGTGAGTCGGTTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176571650 Original CRISPR ACGTGGGTAGTGGGGGGAGC CGG (reversed) Intergenic
No off target data available for this crispr