ID: 1176571964

View in Genome Browser
Species Human (GRCh38)
Location 21:8421412-8421434
Sequence GATACCTCTGCATTGGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176571956_1176571964 11 Left 1176571956 21:8421378-8421400 CCGCAAAGCTGACCTGTCCCACC No data
Right 1176571964 21:8421412-8421434 GATACCTCTGCATTGGCCCGAGG No data
1176571961_1176571964 -7 Left 1176571961 21:8421396-8421418 CCACCGAGGTCAAATGGATACCT No data
Right 1176571964 21:8421412-8421434 GATACCTCTGCATTGGCCCGAGG No data
1176571960_1176571964 -6 Left 1176571960 21:8421395-8421417 CCCACCGAGGTCAAATGGATACC No data
Right 1176571964 21:8421412-8421434 GATACCTCTGCATTGGCCCGAGG No data
1176571958_1176571964 -1 Left 1176571958 21:8421390-8421412 CCTGTCCCACCGAGGTCAAATGG No data
Right 1176571964 21:8421412-8421434 GATACCTCTGCATTGGCCCGAGG No data
1176571962_1176571964 -10 Left 1176571962 21:8421399-8421421 CCGAGGTCAAATGGATACCTCTG No data
Right 1176571964 21:8421412-8421434 GATACCTCTGCATTGGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176571964 Original CRISPR GATACCTCTGCATTGGCCCG AGG Intergenic
No off target data available for this crispr