ID: 1176572129

View in Genome Browser
Species Human (GRCh38)
Location 21:8422046-8422068
Sequence AGGATACATCCAGCACCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176572129_1176572137 24 Left 1176572129 21:8422046-8422068 CCCCCGGGTGCTGGATGTATCCT No data
Right 1176572137 21:8422093-8422115 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176572129 Original CRISPR AGGATACATCCAGCACCCGG GGG (reversed) Intergenic
No off target data available for this crispr