ID: 1176572137

View in Genome Browser
Species Human (GRCh38)
Location 21:8422093-8422115
Sequence GTCGAATTAAACACCTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176572134_1176572137 -8 Left 1176572134 21:8422078-8422100 CCTGAGCCTGACACCGTCGAATT No data
Right 1176572137 21:8422093-8422115 GTCGAATTAAACACCTTGACTGG No data
1176572130_1176572137 23 Left 1176572130 21:8422047-8422069 CCCCGGGTGCTGGATGTATCCTG No data
Right 1176572137 21:8422093-8422115 GTCGAATTAAACACCTTGACTGG No data
1176572129_1176572137 24 Left 1176572129 21:8422046-8422068 CCCCCGGGTGCTGGATGTATCCT No data
Right 1176572137 21:8422093-8422115 GTCGAATTAAACACCTTGACTGG No data
1176572133_1176572137 4 Left 1176572133 21:8422066-8422088 CCTGTCAAGAGACCTGAGCCTGA No data
Right 1176572137 21:8422093-8422115 GTCGAATTAAACACCTTGACTGG No data
1176572131_1176572137 22 Left 1176572131 21:8422048-8422070 CCCGGGTGCTGGATGTATCCTGT No data
Right 1176572137 21:8422093-8422115 GTCGAATTAAACACCTTGACTGG No data
1176572132_1176572137 21 Left 1176572132 21:8422049-8422071 CCGGGTGCTGGATGTATCCTGTC No data
Right 1176572137 21:8422093-8422115 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176572137 Original CRISPR GTCGAATTAAACACCTTGAC TGG Intergenic
No off target data available for this crispr