ID: 1176572421

View in Genome Browser
Species Human (GRCh38)
Location 21:8425089-8425111
Sequence CTTTTTTGAAGGGGCTCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176572410_1176572421 28 Left 1176572410 21:8425038-8425060 CCTCTGCGAGAAGACAGACGGTG No data
Right 1176572421 21:8425089-8425111 CTTTTTTGAAGGGGCTCCGGTGG No data
1176572409_1176572421 29 Left 1176572409 21:8425037-8425059 CCCTCTGCGAGAAGACAGACGGT No data
Right 1176572421 21:8425089-8425111 CTTTTTTGAAGGGGCTCCGGTGG No data
1176572416_1176572421 -6 Left 1176572416 21:8425072-8425094 CCGATTCTGGCAACAGGCTTTTT No data
Right 1176572421 21:8425089-8425111 CTTTTTTGAAGGGGCTCCGGTGG No data
1176572414_1176572421 3 Left 1176572414 21:8425063-8425085 CCGGTTTGGCCGATTCTGGCAAC No data
Right 1176572421 21:8425089-8425111 CTTTTTTGAAGGGGCTCCGGTGG No data
1176572407_1176572421 30 Left 1176572407 21:8425036-8425058 CCCCTCTGCGAGAAGACAGACGG No data
Right 1176572421 21:8425089-8425111 CTTTTTTGAAGGGGCTCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176572421 Original CRISPR CTTTTTTGAAGGGGCTCCGG TGG Intergenic
No off target data available for this crispr