ID: 1176573556

View in Genome Browser
Species Human (GRCh38)
Location 21:8432759-8432781
Sequence GCTCCCCGGCACCCGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176573556_1176573565 -9 Left 1176573556 21:8432759-8432781 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1176573565 21:8432773-8432795 CCGGGGAGCGGTCCCCGGGCCGG No data
1176573556_1176573566 -8 Left 1176573556 21:8432759-8432781 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1176573566 21:8432774-8432796 CGGGGAGCGGTCCCCGGGCCGGG No data
1176573556_1176573567 -2 Left 1176573556 21:8432759-8432781 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1176573567 21:8432780-8432802 GCGGTCCCCGGGCCGGGCCGCGG No data
1176573556_1176573574 22 Left 1176573556 21:8432759-8432781 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1176573574 21:8432804-8432826 CCCTCTGCCGCGATCCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176573556 Original CRISPR GCTCCCCGGCACCCGGGGGA CGG (reversed) Intergenic
No off target data available for this crispr