ID: 1176573852

View in Genome Browser
Species Human (GRCh38)
Location 21:8433774-8433796
Sequence CACCGCCGGCGGGCGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176573852_1176573863 -5 Left 1176573852 21:8433774-8433796 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176573863 21:8433792-8433814 CGGTGCGTGTGGGAAGGCGTGGG No data
1176573852_1176573865 1 Left 1176573852 21:8433774-8433796 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176573865 21:8433798-8433820 GTGTGGGAAGGCGTGGGGTGCGG No data
1176573852_1176573864 -4 Left 1176573852 21:8433774-8433796 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176573864 21:8433793-8433815 GGTGCGTGTGGGAAGGCGTGGGG No data
1176573852_1176573866 8 Left 1176573852 21:8433774-8433796 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176573866 21:8433805-8433827 AAGGCGTGGGGTGCGGACCCCGG No data
1176573852_1176573862 -6 Left 1176573852 21:8433774-8433796 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176573862 21:8433791-8433813 GCGGTGCGTGTGGGAAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176573852 Original CRISPR CACCGCCGGCGGGCGGGGAG AGG (reversed) Intergenic
No off target data available for this crispr