ID: 1176573879

View in Genome Browser
Species Human (GRCh38)
Location 21:8433847-8433869
Sequence CCCCGCGACGCAGAAGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176573879_1176573888 -10 Left 1176573879 21:8433847-8433869 CCGCCGCCTTCTGCGTCGCGGGG No data
Right 1176573888 21:8433860-8433882 CGTCGCGGGGCGGGCCGGCGGGG No data
1176573879_1176573889 3 Left 1176573879 21:8433847-8433869 CCGCCGCCTTCTGCGTCGCGGGG No data
Right 1176573889 21:8433873-8433895 GCCGGCGGGGTCCTCTGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176573879 Original CRISPR CCCCGCGACGCAGAAGGCGG CGG (reversed) Intergenic
No off target data available for this crispr