ID: 1176575432

View in Genome Browser
Species Human (GRCh38)
Location 21:8439488-8439510
Sequence GACGGCCGCCGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176575432_1176575443 -4 Left 1176575432 21:8439488-8439510 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1176575443 21:8439507-8439529 CGTCGGGTGGGGGCTTTACCCGG No data
1176575432_1176575448 25 Left 1176575432 21:8439488-8439510 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1176575448 21:8439536-8439558 TCGCGCGCCTGCCGCGCGTGTGG No data
1176575432_1176575444 -1 Left 1176575432 21:8439488-8439510 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1176575444 21:8439510-8439532 CGGGTGGGGGCTTTACCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176575432 Original CRISPR GACGGCCGCCGCGGCGGCGG CGG (reversed) Intergenic
No off target data available for this crispr