ID: 1176575449

View in Genome Browser
Species Human (GRCh38)
Location 21:8439543-8439565
Sequence GCGCACGCCACACGCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176575449_1176575465 17 Left 1176575449 21:8439543-8439565 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176575465 21:8439583-8439605 GGAACCCCCGGGCGCCTGTGGGG No data
1176575449_1176575463 15 Left 1176575449 21:8439543-8439565 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176575463 21:8439581-8439603 CGGGAACCCCCGGGCGCCTGTGG No data
1176575449_1176575454 -8 Left 1176575449 21:8439543-8439565 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176575454 21:8439558-8439580 GCGTGCGCCCCGCGCCGTGGGGG No data
1176575449_1176575460 5 Left 1176575449 21:8439543-8439565 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176575460 21:8439571-8439593 GCCGTGGGGGCGGGAACCCCCGG No data
1176575449_1176575452 -10 Left 1176575449 21:8439543-8439565 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176575452 21:8439556-8439578 TGGCGTGCGCCCCGCGCCGTGGG No data
1176575449_1176575456 -4 Left 1176575449 21:8439543-8439565 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176575456 21:8439562-8439584 GCGCCCCGCGCCGTGGGGGCGGG No data
1176575449_1176575453 -9 Left 1176575449 21:8439543-8439565 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176575453 21:8439557-8439579 GGCGTGCGCCCCGCGCCGTGGGG No data
1176575449_1176575464 16 Left 1176575449 21:8439543-8439565 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176575464 21:8439582-8439604 GGGAACCCCCGGGCGCCTGTGGG No data
1176575449_1176575455 -5 Left 1176575449 21:8439543-8439565 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176575455 21:8439561-8439583 TGCGCCCCGCGCCGTGGGGGCGG No data
1176575449_1176575466 20 Left 1176575449 21:8439543-8439565 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176575466 21:8439586-8439608 ACCCCCGGGCGCCTGTGGGGTGG No data
1176575449_1176575462 6 Left 1176575449 21:8439543-8439565 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176575462 21:8439572-8439594 CCGTGGGGGCGGGAACCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176575449 Original CRISPR GCGCACGCCACACGCGCGGC AGG (reversed) Intergenic