ID: 1176576676

View in Genome Browser
Species Human (GRCh38)
Location 21:8443684-8443706
Sequence GGCGCCCATCTCCGCCACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176576676_1176576683 25 Left 1176576676 21:8443684-8443706 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1176576683 21:8443732-8443754 ACCGATCCCGGAGAAGCCGGCGG No data
1176576676_1176576682 22 Left 1176576676 21:8443684-8443706 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1176576682 21:8443729-8443751 GCGACCGATCCCGGAGAAGCCGG No data
1176576676_1176576678 -5 Left 1176576676 21:8443684-8443706 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1176576678 21:8443702-8443724 GCGCCGCGAGGCGTCCAGTGCGG No data
1176576676_1176576681 13 Left 1176576676 21:8443684-8443706 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1176576681 21:8443720-8443742 TGCGGTAACGCGACCGATCCCGG No data
1176576676_1176576685 26 Left 1176576676 21:8443684-8443706 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1176576685 21:8443733-8443755 CCGATCCCGGAGAAGCCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176576676 Original CRISPR GGCGCCCATCTCCGCCACTC CGG (reversed) Intergenic
No off target data available for this crispr