ID: 1176576679

View in Genome Browser
Species Human (GRCh38)
Location 21:8443705-8443727
Sequence TTACCGCACTGGACGCCTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176576679_1176576685 5 Left 1176576679 21:8443705-8443727 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1176576685 21:8443733-8443755 CCGATCCCGGAGAAGCCGGCGGG No data
1176576679_1176576688 13 Left 1176576679 21:8443705-8443727 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1176576688 21:8443741-8443763 GGAGAAGCCGGCGGGAGCCCCGG No data
1176576679_1176576682 1 Left 1176576679 21:8443705-8443727 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1176576682 21:8443729-8443751 GCGACCGATCCCGGAGAAGCCGG No data
1176576679_1176576689 14 Left 1176576679 21:8443705-8443727 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1176576689 21:8443742-8443764 GAGAAGCCGGCGGGAGCCCCGGG No data
1176576679_1176576690 15 Left 1176576679 21:8443705-8443727 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1176576690 21:8443743-8443765 AGAAGCCGGCGGGAGCCCCGGGG No data
1176576679_1176576683 4 Left 1176576679 21:8443705-8443727 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1176576683 21:8443732-8443754 ACCGATCCCGGAGAAGCCGGCGG No data
1176576679_1176576681 -8 Left 1176576679 21:8443705-8443727 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1176576681 21:8443720-8443742 TGCGGTAACGCGACCGATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176576679 Original CRISPR TTACCGCACTGGACGCCTCG CGG (reversed) Intergenic
No off target data available for this crispr