ID: 1176576680

View in Genome Browser
Species Human (GRCh38)
Location 21:8443716-8443738
Sequence GATCGGTCGCGTTACCGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176576680_1176576696 29 Left 1176576680 21:8443716-8443738 CCAGTGCGGTAACGCGACCGATC No data
Right 1176576696 21:8443768-8443790 AGTTCTCTTTTCTTTGTGAAGGG No data
1176576680_1176576695 28 Left 1176576680 21:8443716-8443738 CCAGTGCGGTAACGCGACCGATC No data
Right 1176576695 21:8443767-8443789 GAGTTCTCTTTTCTTTGTGAAGG No data
1176576680_1176576689 3 Left 1176576680 21:8443716-8443738 CCAGTGCGGTAACGCGACCGATC No data
Right 1176576689 21:8443742-8443764 GAGAAGCCGGCGGGAGCCCCGGG No data
1176576680_1176576682 -10 Left 1176576680 21:8443716-8443738 CCAGTGCGGTAACGCGACCGATC No data
Right 1176576682 21:8443729-8443751 GCGACCGATCCCGGAGAAGCCGG No data
1176576680_1176576688 2 Left 1176576680 21:8443716-8443738 CCAGTGCGGTAACGCGACCGATC No data
Right 1176576688 21:8443741-8443763 GGAGAAGCCGGCGGGAGCCCCGG No data
1176576680_1176576690 4 Left 1176576680 21:8443716-8443738 CCAGTGCGGTAACGCGACCGATC No data
Right 1176576690 21:8443743-8443765 AGAAGCCGGCGGGAGCCCCGGGG No data
1176576680_1176576685 -6 Left 1176576680 21:8443716-8443738 CCAGTGCGGTAACGCGACCGATC No data
Right 1176576685 21:8443733-8443755 CCGATCCCGGAGAAGCCGGCGGG No data
1176576680_1176576683 -7 Left 1176576680 21:8443716-8443738 CCAGTGCGGTAACGCGACCGATC No data
Right 1176576683 21:8443732-8443754 ACCGATCCCGGAGAAGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176576680 Original CRISPR GATCGGTCGCGTTACCGCAC TGG (reversed) Intergenic
No off target data available for this crispr