ID: 1176576685

View in Genome Browser
Species Human (GRCh38)
Location 21:8443733-8443755
Sequence CCGATCCCGGAGAAGCCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176576679_1176576685 5 Left 1176576679 21:8443705-8443727 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1176576685 21:8443733-8443755 CCGATCCCGGAGAAGCCGGCGGG No data
1176576680_1176576685 -6 Left 1176576680 21:8443716-8443738 CCAGTGCGGTAACGCGACCGATC No data
Right 1176576685 21:8443733-8443755 CCGATCCCGGAGAAGCCGGCGGG No data
1176576676_1176576685 26 Left 1176576676 21:8443684-8443706 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1176576685 21:8443733-8443755 CCGATCCCGGAGAAGCCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176576685 Original CRISPR CCGATCCCGGAGAAGCCGGC GGG Intergenic
No off target data available for this crispr