ID: 1176577539

View in Genome Browser
Species Human (GRCh38)
Location 21:8446829-8446851
Sequence CGGAGCGTCCCCGTCTCGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176577529_1176577539 21 Left 1176577529 21:8446785-8446807 CCACCGAGCGGCGTGTAGGAGTG No data
Right 1176577539 21:8446829-8446851 CGGAGCGTCCCCGTCTCGGTCGG No data
1176577533_1176577539 -2 Left 1176577533 21:8446808-8446830 CCCGTCGGGACGAACCGCAACCG No data
Right 1176577539 21:8446829-8446851 CGGAGCGTCCCCGTCTCGGTCGG No data
1176577534_1176577539 -3 Left 1176577534 21:8446809-8446831 CCGTCGGGACGAACCGCAACCGG No data
Right 1176577539 21:8446829-8446851 CGGAGCGTCCCCGTCTCGGTCGG No data
1176577527_1176577539 27 Left 1176577527 21:8446779-8446801 CCTTCTCCACCGAGCGGCGTGTA No data
Right 1176577539 21:8446829-8446851 CGGAGCGTCCCCGTCTCGGTCGG No data
1176577530_1176577539 18 Left 1176577530 21:8446788-8446810 CCGAGCGGCGTGTAGGAGTGCCC No data
Right 1176577539 21:8446829-8446851 CGGAGCGTCCCCGTCTCGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176577539 Original CRISPR CGGAGCGTCCCCGTCTCGGT CGG Intergenic
No off target data available for this crispr